| Aliases | Brain5 | Scientific name | Zebrafish | ||||
| Organism | Danio rerio | Genome Locus | chr23:29851554-29851668 | ||||
| CircRNA type | n/a | Gene ID | n/a | ||||
| Gene Name | clstn1 | Detection pipeline | FindCirc | ||||
| Sample Type | Brain | ||||||||
| Method for Estimation | Quantitative-PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CCACAGTCATAGGCAGTCAC | ||||||||
| Reverse Primer | AAAACCGAGCATCCGAGGAC | ||||||||