| Aliases | ghi_circ_000138 | Scientific name | Gossypium hirsutum | ||||
| Organism | Cotton | Genome Locus | chrA09:72304360-72311217:n/a | ||||
| CircRNA type | ag-circRNA | Gene ID | n/a | ||||
| Gene Name | n/a | Detection pipeline | CIRI | ||||
| Sample Type | Zero DPA (Days Post Anthesis) ovule and young leaf | ||||||||
| Method for Estimation | n/a | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | n/a | ||||||||
| Reverse Primer | n/a | ||||||||
| Aliases | A09:72304360|72311217 | Scientific name | Gossypium hirsutum | ||||
| Organism | Cotton | Genome Locus | chrA09:72304360-72311217:n/a | ||||
| CircRNA type | intergenic | Gene ID | n/a | ||||
| Gene Name | n/a | Detection pipeline | CIRI | ||||
| Sample Type | Zero DPA (Days Post Anthesis) ovule and young leaf | ||||||||
| Method for Estimation | Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | TTGAGTCCTTCAGAAGCAA | ||||||||
| Reverse Primer | AGAAAGATTCGTTTGAGAGC | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |