| Aliases | scaffold1555_A06:11136|11866 | Scientific name | Gossypium hirsutum | ||||
| Organism | Cotton | Genome Locus | chrscaffold1555_A06:11136-11866:+ | ||||
| CircRNA type | Exonic | Gene ID | n/a | ||||
| Gene Name | Gh_A06G2109 | Detection pipeline | CIRI | ||||
| Sample Type | Zero DPA (Days Post Anthesis) ovule and young leaf | ||||||||
| Method for Estimation | Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | TATTCGCTCTGCTATTGACT | ||||||||
| Reverse Primer | GCTGCTTTCGATCAAGATTA | ||||||||