| Aliases | Gm03circRNA1785 | Scientific name | Glycine max | ||||
| Organism | Soybean | Genome Locus | Gm03:36307484-36314037:+ | ||||
| CircRNA type | exonic | Gene ID | n/a | ||||
| Gene Name | GLYMA03G28410 | Detection pipeline | CIRI | ||||
| Sample Type | leaf;root and stem tissues | ||||||||
| Method for Estimation | n/a | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | n/a | ||||||||
| Reverse Primer | n/a | ||||||||
| Aliases | Gm03circRNA1785 | Scientific name | Glycine max | ||||
| Organism | Soybean | Genome Locus | Gm03:36307484-36314037:+ | ||||
| CircRNA type | exonic | Gene ID | n/a | ||||
| Gene Name | GLYMA03G28410 | Detection pipeline | CIRI | ||||
| Sample Type | leaf;root and stem tissues | ||||||||
| Method for Estimation | Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CCAGGCTTCAAAGACCGCA | ||||||||
| Reverse Primer | ATCCAGAATGGCCTGCGAAT | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |