| Aliases | hsa_circ_0000594 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr15:43120125-43164956:- | ||||
| CircRNA type | . | Gene ID | ENSG00000128881.12 | ||||
| Gene Name | TTBK2 | Detection pipeline | . | ||||
| Sample Type | cd_19; K562; H1hesc; Ag04450; A549; Sknshra | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_14372 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr15:43120125-43164956 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | K562;SH-SY5Y_D0_exp2;Heart;Diencephalon;Liver_T7;Liver_T12;Hs68;Liver_N19;Liver_N21;Liver_T20 | ||||||||
| Method for Estimation | poly(A)-;Ribo-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circTTBK2/hsa_circ_0000594 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr15:43120125-43164956:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000128881.12 | ||||
| Gene Name | TTBK2 | Detection pipeline | N/A | ||||
| Sample Type | Gliomas | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | AGTGCAACATTTTCCCTGGTG | ||||||||
| Reverse Primer | GCTTGATTTTGGCTTGGCTC | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |