| Aliases | hsa_circ_0001982 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr15:59323002-59323901:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000157450.11 | ||||
| Gene Name | RNF111 | Detection pipeline | . | ||||
| Sample Type | Hs68_RNase; Hs68_control; Nhek; K562; Hepg2; Ag04450; A549; Sknshra | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_14912 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr15:59323002-59323901 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | A549;Forebrain;SH-SY5Y_D0_exp2;Parietal;AG04450;BJ;Cerebellum;Liver_N15;Liver_N14;H9;Stomach;Diencephalon;Liver_T8;Occipital;Heart;Liver_N13;PA1;Liver;Temporal;Liver_T7;HeLa_S3;Liver_N6;NHEK;H1;Liver_N3;Liver_T10;Liver_T14;SH-SY5Y_D2_exp1;Liver_T11;SH-SY5Y_D0_exp1;Liver_T6;Liver_N11;Liver_N10;Liver_T12;K562;Cortex;HepG2;Lung;Liver_T3;Liver_N7;Liver_T15;Hs68;Liver_N17;Liver_T19;Liver_N22;Liver_N21;Liver_T17;Liver_N19;Liver_T21;Liver_N20;Liver_T22 | ||||||||
| Method for Estimation | poly(A)-;Ribo-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_003805 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr15:59323002-59323901:+ | ||||
| CircRNA type | n/a | Gene ID | ENSG00000157450.11 | ||||
| Gene Name | RNF111 | Detection pipeline | Find_circ | ||||
| Sample Type | colorectal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0001982 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr15:59323002-59323901:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000157450.11 | ||||
| Gene Name | RNF111 | Detection pipeline | N/A | ||||
| Sample Type | breast cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | TAGCAGTTCCCCAATCCTTG | ||||||||
| Reverse Primer | CACAAATTCCCATCATTCCC | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |