| Aliases | hsa_circRNA_101541 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr15:60653139-60674640:n/a | ||||
| CircRNA type | exonic | Gene ID | ENSG00000182718.12 | ||||
| Gene Name | ANXA2 | Detection pipeline | n/a | ||||
| Sample Type | Cystic fibrosis(CF) | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0035560 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr15:60653139-60674640:- | ||||
| CircRNA type | . | Gene ID | ENSG00000069667.15 | ||||
| Gene Name | RORA | Detection pipeline | . | ||||
| Sample Type | Nhek; K562; Huvec; Hsmm; Hmec; Hepg2; Helas3; Bj; Ag04450; A549; Nhlf; Sknshra | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_14984 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr15:60653139-60674640 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Liver_N11;AG04450;Liver_T12;PA1;Parietal;Stomach;HeLa_S3;Heart;K562;BJ;A549;NHEK;Hs68 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_101541 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr15:60653139-60674640:- | ||||
| CircRNA type | exonic | Gene ID | ENSG00000069667.15 | ||||
| Gene Name | RORA | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0005402 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr15:60653139-60674640:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000069667.15 | ||||
| Gene Name | RORA | Detection pipeline | N/A | ||||
| Sample Type | Multiple sclerosis | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | TTTCGGACACATCTGGTGAC | ||||||||
| Reverse Primer | CCGCTCAGCATCAAAGTTAGT | ||||||||
| Aliases | hsa_circ_0035560 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr15:60653139-60674640:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000069667.15 | ||||
| Gene Name | RORA | Detection pipeline | N/A | ||||
| Sample Type | Multiple sclerosis | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CACCTGGAGACGGTGATTTT | ||||||||
| Reverse Primer | CCGCTCAGCATCAAAGTTAGT | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |