Aliases hsa_circ_0002138 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr15:63824845-63855207:+
CircRNA type . Gene ID ENSG00000259248.1;ENSG00000140455.12
Gene Name USP3-AS1;USP3 Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; Nhek; K562; Huvec; Hepg2; Helas3; Gm12878; Bj; Ag04450; A549; Sknshra; Mcf7
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_15046 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr15:63824845-63855207
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver_N14;Liver_N11;Liver_T13;PA1;Liver_T3;GM12878;Forebrain;Liver_N7;SH-SY5Y_D4_exp1;BJ;Stomach;SH-SY5Y_D0_exp1;Occipital;Temporal;AG04450;H9;SH-SY5Y_D0_exp2;HeLa_S3;Cortex;A549;Liver_T14;Liver_T10;Liver_N6;Liver_N13;Liver_T15;SH-SY5Y_D4_exp2;Diencephalon;Liver_T7;Liver_N10;Liver_T8;Liver_N3;Thyroid;Liver_N15;Parietal;HepG2;Heart;Liver_T12;K562;Liver_N12;Liver;Liver_T6;Cerebellum;Liver_T11;Hs68;Liver_N20;Liver_T21;Liver_T19;Liver_T22;Liver_N22;Liver_N18;Liver_T18;Liver_N17;Liver_T17;Liver_N21
Method for Estimation Ribo-;RNaseR;poly(A)-
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases circ_003204 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr15:63824845-63855207:+
CircRNA type n/a Gene ID ENSG00000259248.1;ENSG00000140455.12
Gene Name USP3-AS1;USP3 Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25624062
Aliases hsa_circRNA_101546 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr15:63824845-63855207:+
CircRNA type exonic Gene ID ENSG00000259248.1;ENSG00000140455.12
Gene Name USP3-AS1;USP3 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases circ3204/hsa_circ_0002138 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr15:63824845-63855207:+
CircRNA type N/A Gene ID ENSG00000259248.1;ENSG00000140455.12
Gene Name USP3-AS1;USP3 Detection pipeline N/A
Sample Type Colorectal cancer
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer TTAGCCCAGAGTCCTTATTTTATG
Reverse Primer TGGACCGGCACACTAAAGT
Pubmed 25624062
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size