| Aliases | hsa_circ_0000615 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr15:64791491-64792365:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000180357.5 | ||||
| Gene Name | ZNF609 | Detection pipeline | . | ||||
| Sample Type | cd_19; Hs68_RNase; Hs68_control | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_001446 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr15:64791491-64792365:+ | ||||
| CircRNA type | n/a | Gene ID | ENSG00000180357.5 | ||||
| Gene Name | ZNF609 | Detection pipeline | Find_circ | ||||
| Sample Type | colorectal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | Circ-ZNF609/hsa_circ_0000615 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr15:64791491-64792365:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000180357.5 | ||||
| Gene Name | ZNF609 | Detection pipeline | N/A | ||||
| Sample Type | Hirschsprung disease | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CAGCGCTCAATCCTTTGGGA | ||||||||
| Reverse Primer | GACCTGCCACATTGGTCAGTA | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |