| Aliases | chr15:76566752|76588078 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr15:76566752-76588078:n/a | ||||
| CircRNA type | n/a | Gene ID | ENSG00000140374.11 | ||||
| Gene Name | ETFA | Detection pipeline | n/a | ||||
| Sample Type | Breast cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0000638 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr15:76566752-76588078:- | ||||
| CircRNA type | . | Gene ID | ENSG00000140386.12 | ||||
| Gene Name | SCAPER | Detection pipeline | . | ||||
| Sample Type | HEK293; cd_19; Hs68_RNase; Hs68_control; Nhek; K562; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra; Mcf7 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_15745 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr15:76566752-76588078 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Liver_N12;Occipital;H1;Liver_T10;SH-SY5Y_D0_exp2;Liver_N3;H9;Liver_T13;Liver_N15;Forebrain;Liver;Liver_N13;Liver_N14;Liver_T8;Stomach;SH-SY5Y_D0_exp1;Cerebellum;Liver_T15;GM12878;Cortex;PA1;AG04450;SH-SY5Y_D2_exp1;Parietal;HepG2;Thyroid;Liver_N7;BJ;Liver_N6;SH-SY5Y_D4_exp2;Diencephalon;HUVEC;Liver_N11;Temporal;HeLa_S3;Liver_T12;Liver_N10;SH-SY5Y_D4_exp1;Heart;Liver_T7;Liver_T11;K562;A549;Lung;NHEK;Liver_T14;Liver_T6;Liver_T3;Hs68;Liver_T17;Liver_N22;Liver_T19;Liver_N18;Liver_T22;Liver_N20;Liver_N17;Liver_N19;Liver_N21;Liver_T21 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | chr15:76566752-76588078 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr15:76566752-76588078:n/a | ||||
| CircRNA type | n/a | Gene ID | ENSG00000140374.11 | ||||
| Gene Name | ETFA | Detection pipeline | UROBORUS | ||||
| Sample Type | gliomas | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_101604 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr15:76566752-76588078:- | ||||
| CircRNA type | exonic | Gene ID | ENSG00000140386.12 | ||||
| Gene Name | SCAPER | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circETFA | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr15:76566752-76588078:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000140386.12 | ||||
| Gene Name | SCAPER | Detection pipeline | N/A | ||||
| Sample Type | breast cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | TTTTATCTCCTCCTCTCACAGCC | ||||||||
| Reverse Primer | GTTCCAGCTACTAAGCAGGACACT | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |