Aliases hsa_circ_0005529 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr15:91542906-91543205:-
CircRNA type . Gene ID ENSG00000184056.10
Gene Name VPS33B Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; Nhek; K562; Hepg2; Helas3; Bj; Ag04450; A549; Nhlf; Sknshra
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases HSA_CIRCpedia_16172 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr15:91542906-91543205
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type A549;HUVEC;SH-SY5Y_D2_exp1;Temporal;HeLa_S3;NHEK;Diencephalon;Liver;Occipital;H1;Parietal;Liver_N13;GM12878;PA1;H9;K562;BJ;AG04450;Hs68;Liver_T21
Method for Estimation poly(A)-;Ribo-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circRNA_101650 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr15:91542906-91543205:-
CircRNA type exonic Gene ID ENSG00000184056.10
Gene Name VPS33B Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circ_0005529 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr15:91542906-91543205:-
CircRNA type N/A Gene ID ENSG00000184056.10
Gene Name VPS33B Detection pipeline N/A
Sample Type Gastric cancer
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer AGTCCCTGCGCCTCATCTTG
Reverse Primer CGCCGCTCTAGCACCTTTCT
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size