| Aliases | hsa_circ_0006633 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:59805629-59844509:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000134709.10 | ||||
| Gene Name | HOOK1 | Detection pipeline | . | ||||
| Sample Type | Hs68_RNase; Hs68_control; Nhek; K562; H1hesc; Gm12878; Ag04450 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_32560 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:59805629-59844509 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Cortex;Diencephalon;PA1;SH-SY5Y_D8_exp2;Liver_T10;Temporal;BJ;Liver_N7;Heart;SH-SY5Y_D4_exp1;Liver_T15;Liver_N10;Liver_N13;Liver_N15;SH-SY5Y_D0_exp1;SH-SY5Y_D2_exp1;K562;Lung;Liver_T12;Parietal;Liver_T14;Liver_T6;AG04450;Liver_N6;Cerebellum;Liver_T8;H9;Liver_T13;Liver_N12;Liver_N14;Liver_T3;Liver_T11;GM12878;Liver_N3;Occipital;A549;NHEK;Stomach;Liver_N11;Liver_T7;HeLa_S3;Liver_N8;Thyroid;Liver;H1;Hs68;Liver_T20;Liver_T19;Liver_N22;Liver_N18;Liver_T17;Liver_T18;Liver_N21;Liver_T21;Liver_T22;Liver_N20;Liver_N17;Liver_N19 | ||||||||
| Method for Estimation | Ribo-;RNaseR;poly(A)- | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_007244 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:59805629-59844509:+ | ||||
| CircRNA type | n/a | Gene ID | ENSG00000134709.10 | ||||
| Gene Name | HOOK1 | Detection pipeline | Find_circ | ||||
| Sample Type | colorectal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | chr1:59805629-59844509 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:59805629-59844509:n/a | ||||
| CircRNA type | n/a | Gene ID | ENSG00000172456.12 | ||||
| Gene Name | FGGY | Detection pipeline | UROBORUS | ||||
| Sample Type | gliomas | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0006633 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:59805629-59844509:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000134709.10 | ||||
| Gene Name | HOOK1 | Detection pipeline | N/A | ||||
| Sample Type | Gastric cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CTCCCGGACTTCTTATCGTGG | ||||||||
| Reverse Primer | CGATGGTCCAGCCACATGAT | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |