Aliases hsa_circ_0000257 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr10:103916775-103917971:+
CircRNA type . Gene ID ENSG00000107960.10
Gene Name STN1 Detection pipeline .
Sample Type HEK293; cd_19; Hs68_RNase; Hs68_control; Nhek; K562; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases HSA_CIRCpedia_206 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr10:103916775-103917971
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type SH-SY5Y_D0_exp1;Liver_T6;Forebrain;Liver_N8;Liver;Thyroid;Liver_T8;Temporal;Liver_N12;SH-SY5Y_D2_exp1;Liver_N13;SH-SY5Y_D4_exp1;Liver_T15;H9;Parietal;Liver_N7;AG04450;HepG2;Liver_N15;PA1;Liver_N3;SH-SY5Y_D4_exp2;Liver_T7;Cerebellum;A549;Liver_N14;HeLa_S3;K562;Liver_T14;GM12878;Liver_N11;H1;SH-SY5Y_D0_exp2;SH-SY5Y_D8_exp2;Cortex;NHEK;BJ;Diencephalon;Occipital;Hs68;Liver_T18;Liver_T17;Liver_T21;Liver_T20;Liver_N21;Liver_N19;Liver_N17;Liver_T22;Liver_N20
Method for Estimation Ribo-;RNaseR;poly(A)-
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_003192 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr10:103916775-103917971:+
CircRNA type n/a Gene ID ENSG00000107960.10
Gene Name STN1 Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circRNA_100674 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr10:103916775-103917971:+
CircRNA type exonic Gene ID ENSG00000107960.10
Gene Name STN1 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circ_0000257 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr10:103916775-103917971:n/a
CircRNA type n/a Gene ID NA
Gene Name NA Detection pipeline n/a
Sample Type cervical carcinoma
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circ_0000257 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr10:103916775-103917971:+
CircRNA type N/A Gene ID ENSG00000107960.10
Gene Name STN1 Detection pipeline N/A
Sample Type Pancreatic Ductal Adenocarcinoma
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer AGGATGAGCCACCAAAGAAC
Reverse Primer TGTCTAAGAGGGAAGAGGCATT
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size