| Aliases | hsa_circ_0009128 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr16:11815432-11830089:- | ||||
| CircRNA type | . | Gene ID | ENSG00000153066.8 | ||||
| Gene Name | TXNDC11 | Detection pipeline | . | ||||
| Sample Type | Hs68_RNase; Hs68_control; K562; Hepg2; Gm12878; Bj | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_16332 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr16:11815432-11830089 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Liver_T15;Cerebellum;H9;Liver_T8;Thyroid;Liver_T3;Diencephalon;Liver_N6;Liver_N7;Temporal;H1;K562;PA1;Liver_N3;Liver_N8;Liver;Liver_T7;BJ;Occipital;A549;HUVEC;Liver_N13;Liver_N12;HepG2;Liver_T14;Liver_N11;Liver_N10;Liver_N15;HeLa_S3;Cortex;GM12878;Liver_T12;Liver_T13;Hs68;Liver_N19;Liver_T17;Liver_N21;Liver_T19;Liver_N17;Liver_N18;Liver_T20;Liver_N22 | ||||||||
| Method for Estimation | Ribo-;RNaseR;poly(A)- | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0009128 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr16:11815432-11830089:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000153066.8 | ||||
| Gene Name | TXNDC11 | Detection pipeline | N/A | ||||
| Sample Type | Active Pulmonary Tuberculosis | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | AAGAGGTCAAGGACTGGAGA | ||||||||
| Reverse Primer | TTGACCTTCTTCACCTCAGC | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |