| Aliases | hsa_circ_0000677 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr16:16101672-16162159:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000091262.15 | ||||
| Gene Name | ABCC6 | Detection pipeline | . | ||||
| Sample Type | cd_19 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_16557 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr16:16101672-16162159 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | A549;Liver_N11;Liver_N20 | ||||||||
| Method for Estimation | poly(A)-;Ribo- | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0000677/hsa_circ_001569/circABCC | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr16:16101672-16162159:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000091262.15 | ||||
| Gene Name | ABCC6 | Detection pipeline | N/A | ||||
| Sample Type | Colorectal cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | TCCCCTGAACATTCTCCCCAT | ||||||||
| Reverse Primer | GAAAGCACTTGGTGAAGTCGG | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |