| Aliases | hsa_circ_0038374 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr16:19741751-19745149:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000174628.16 | ||||
| Gene Name | IQCK | Detection pipeline | . | ||||
| Sample Type | A549 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_16859 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr16:19741751-19745149 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | H9;Liver;Liver_N12;Parietal;SH-SY5Y_D4_exp1;Occipital;Liver_N10;Liver_N14;Forebrain;Lung;Diencephalon;Liver_N6;Cerebellum;Heart;PA1;Thyroid;Liver_N15;SH-SY5Y_D0_exp2;K562;Cortex;Hs68;Liver_N19;Liver_N17 | ||||||||
| Method for Estimation | RNaseR;Ribo-;poly(A)- | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | IQCK/hsa_circ_0038374 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr16:19741751-19745149:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000174628.16 | ||||
| Gene Name | IQCK | Detection pipeline | N/A | ||||
| Sample Type | Multiple system atrophy (MSA) | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | TTGCGCCAGTAGAGGAAATG | ||||||||
| Reverse Primer | GCTTCATACTCTCAAAACAT | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |