| Aliases | hsa_circ_0000681 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr16:23999828-24046868:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000166501.8 | ||||
| Gene Name | PRKCB | Detection pipeline | . | ||||
| Sample Type | HEK293; cd_19; neutr; K562; H1hesc; Gm12878 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_17062 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr16:23999828-24046868 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Temporal;Liver_N11;Liver_N12;Liver;Parietal;Cerebellum;H1;GM12878;Lung;K562;Diencephalon;Cortex;Occipital;Liver_T19;Liver_T17;Liver_N17 | ||||||||
| Method for Estimation | Ribo-;poly(A)- | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_005447 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr16:23999828-24046868:+ | ||||
| CircRNA type | n/a | Gene ID | ENSG00000166501.8 | ||||
| Gene Name | PRKCB | Detection pipeline | Find_circ | ||||
| Sample Type | colorectal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_101762 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr16:23999828-24046868:+ | ||||
| CircRNA type | exonic | Gene ID | ENSG00000166501.8 | ||||
| Gene Name | PRKCB | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0000681 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr16:23999828-24046868:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000166501.8 | ||||
| Gene Name | PRKCB | Detection pipeline | N/A | ||||
| Sample Type | Pulmonary tuberculosis | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GATGAATGTTCCCAGCCTGT | ||||||||
| Reverse Primer | AGGGCAGGAGAATGTGACAA | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |