Aliases hsa_circ_0006127 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr16:30740286-30740893:+
CircRNA type . Gene ID ENSG00000281991.1
Gene Name TMEM265 Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; Nhek; K562; Huvec; Hsmm; Hmec; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Nhlf; Sknshra; Mcf7
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_17450 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr16:30740286-30740893
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver_T10;Thyroid;Liver_N11;H9;AG04450;BJ;Forebrain;Cerebellum;SH-SY5Y_D2_exp1;HUVEC;Liver_T12;SH-SY5Y_D8_exp2;HeLa_S3;SH-SY5Y_D4_exp1;Liver_N6;SH-SY5Y_D0_exp2;Temporal;HepG2;Liver_N10;Liver_T6;Liver_T7;Liver_N12;Liver_N3;Parietal;PA1;Liver_N14;Liver_N7;Occipital;Liver_N15;Liver_N8;K562;Liver_T15;Stomach;SK_N_SH;Liver;Cortex;GM12878;Heart;Lung;Liver_T3;Liver_T13;SH-SY5Y_D0_exp1;Diencephalon;Liver_T14;Liver_T11;Kidney;NHEK;H1;A549;Liver_N13;Liver_T8;Hs68;Liver_T20;Liver_T19;Liver_N19;Liver_T22;Liver_T21;Liver_N22;Liver_N18;Liver_T17;Liver_N17;Liver_N21;Liver_T18;Liver_N20
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases circ_000373 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr16:30740286-30740893:+
CircRNA type n/a Gene ID ENSG00000281991.1
Gene Name TMEM265 Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25624062
Aliases hsa_circRNA_101800 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr16:30740286-30740893:+
CircRNA type exonic Gene ID ENSG00000281991.1
Gene Name TMEM265 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circ_0006127 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr16:30740286-30740893:+
CircRNA type N/A Gene ID ENSG00000281991.1
Gene Name TMEM265 Detection pipeline N/A
Sample Type Gastric cancer
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer CCTTTGCACCGTATTGTGTG
Reverse Primer GGCAGGGTACAGAAATCCAG
Pubmed 28974900
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size