Aliases hsa_circ_0007788 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr16:4516153-4519466:-
CircRNA type . Gene ID ENSG00000153406.9
Gene Name NMRAL1 Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; Nhek; K562; Huvec; Hmec; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra; Mcf7
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_17606 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr16:4516153-4519466
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver_N7;Liver_N14;BJ;Occipital;AG04450;Liver_T14;Cortex;Thyroid;SK_N_SH;Liver_T11;Parietal;SH-SY5Y_D0_exp1;NHEK;A549;HeLa_S3;Diencephalon;Liver_N6;Lung;PA1;Liver_N8;SH-SY5Y_D8_exp2;HUVEC;Liver_N13;Temporal;H9;SH-SY5Y_D2_exp1;Liver_N11;Liver_T13;HepG2;SH-SY5Y_D4_exp2;Liver_N3;Liver;Cerebellum;Heart;Kidney;Liver_T15;Liver_N12;Liver_N15;Liver_T8;H1;GM12878;K562;Forebrain;Liver_T6;SH-SY5Y_D4_exp1;Hs68;Liver_T22;Liver_N19;Liver_N22;Liver_N20;Liver_T18;Liver_N17;Liver_T19;Liver_T21;Liver_N18;Liver_T20;Liver_T17;Liver_N21
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases circ_005439 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr16:4516153-4519466:-
CircRNA type n/a Gene ID ENSG00000153406.9
Gene Name NMRAL1 Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25624062
Aliases hsa_circRNA_101693 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr16:4516153-4519466:-
CircRNA type exonic Gene ID ENSG00000153406.9
Gene Name NMRAL1 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circ_0007788 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr16:4516153-4519466:-
CircRNA type N/A Gene ID ENSG00000153406.9
Gene Name NMRAL1 Detection pipeline N/A
Sample Type Postmenopausal Osteoporosis
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer CTCCCACTTCTTGCCCCAGA
Reverse Primer CCCTGGGCACTCAGCAACTA
Pubmed 29742503
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size