Aliases hsa_circ_0005941 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr16:53907697-53922863:+
CircRNA type . Gene ID ENSG00000140718.20
Gene Name FTO Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; Nhek; K562; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_17902 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr16:53907697-53922863
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver_N15;H9;Forebrain;Liver_N12;Liver_N7;Liver_T6;Liver_T8;GM12878;Liver;Liver_N6;Thyroid;Cortex;Liver_T11;Liver_T13;SH-SY5Y_D0_exp1;Diencephalon;Liver_T12;PA1;Temporal;H1;SH-SY5Y_D2_exp1;Cerebellum;HepG2;Occipital;Parietal;HeLa_S3;HUVEC;Liver_T15;SH-SY5Y_D0_exp2;Liver_T3;Heart;Liver_N3;SH-SY5Y_D8_exp2;Liver_N11;Lung;Stomach;A549;BJ;NHEK;Liver_N13;AG04450;K562;Liver_N8;Liver_T7;Liver_N14;Liver_N10;Liver_T14;Hs68;Liver_N18;Liver_T20;Liver_T18;Liver_T22;Liver_N19;Liver_T17;Liver_N17;Liver_N20;Liver_N22;Liver_T21;Liver_N21
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases circ_007988 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr16:53907697-53922863:+
CircRNA type n/a Gene ID ENSG00000140718.20
Gene Name FTO Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25624062
Aliases chr16:53907697-53922863 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr16:53907697-53922863:n/a
CircRNA type n/a Gene ID ENSG00000140718.14
Gene Name FTO Detection pipeline UROBORUS
Sample Type gliomas
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 26873924
Aliases hsa_circRNA_101816 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr16:53907697-53922863:+
CircRNA type exonic Gene ID ENSG00000140718.20
Gene Name FTO Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases circRNA_0005941 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr16:53907697-53922863:+
CircRNA type N/A Gene ID ENSG00000140718.20
Gene Name FTO Detection pipeline N/A
Sample Type Acne
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer AACCCATGGCTCAACTGGAA
Reverse Primer TGGGTGGAACTAAACCGAGG
Pubmed 29573483
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size