Aliases hsa_circ_0008450 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr16:66642211-66643906:+
CircRNA type . Gene ID ENSG00000183723.12
Gene Name CMTM4 Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; K562; Huvec; Helas3; Gm12878; Bj; Ag04450; A549; Sknshra
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_18116 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr16:66642211-66643906
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver_T11;PA1;NHEK;Liver_N8;Liver_N6;BJ;GM12878;Parietal;Diencephalon;Occipital;AG04450;Liver_N13;Liver_N12;Stomach;Cerebellum;H1;Liver;Heart;Lung;A549;HeLa_S3;Liver_T14;Liver_N10;Liver_T7;H9;Liver_N11;HepG2;K562;Liver_T10;Liver_T12;HUVEC;SH-SY5Y_D2_exp1;Cortex;Temporal;Hs68;Liver_N17;Liver_N20;Liver_T18;Liver_T17;Liver_N22;Liver_T21;Liver_T19
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases hsa_circ_0008450 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr16:66642211-66643906:+
CircRNA type N/A Gene ID ENSG00000183723.12
Gene Name CMTM4 Detection pipeline N/A
Sample Type Liver cell carcinoma
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer GGACTCTGCAGATGAGACCA
Reverse Primer AAGTACAAGGCCAGCAGGAAC
Pubmed 30018710
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size