| Aliases | hsa_circ_0092374 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:68151221-68151421:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000116729.13 | ||||
| Gene Name | WLS | Detection pipeline | . | ||||
| Sample Type | H9 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_400011 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:68151221-68151421:+ | ||||
| CircRNA type | intronic | Gene ID | ENSG00000116729.13 | ||||
| Gene Name | WLS | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_400011/hsa_circ_0092374 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:68151221-68151421:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000116729.13 | ||||
| Gene Name | WLS | Detection pipeline | N/A | ||||
| Sample Type | Systemic Lupus Erythematosus | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | AACTCCCGCCCTTGCTCCCT | ||||||||
| Reverse Primer | TCCCCTGCAAGCCTTCCACA | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |