| Aliases | hsa_circ_0040705 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr16:84792321-84801964:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000103194.11 | ||||
| Gene Name | USP10 | Detection pipeline | . | ||||
| Sample Type | K562; Mcf7 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_18939 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr16:84792321-84801964 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Liver;Liver_N10;Kidney;Parietal;K562;Liver_T12;Temporal;GM12878;Cortex;Liver_N15;Cerebellum;Diencephalon;H1;Heart;PA1;Liver_N14;Thyroid;Liver_T7;Liver_T14;Liver_N12;SH-SY5Y_D0_exp1;Hs68;Liver_N20;Liver_N19;Liver_N17;Liver_T19;Liver_T21 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_101889 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr16:84792321-84801964:+ | ||||
| CircRNA type | exonic | Gene ID | ENSG00000103194.11 | ||||
| Gene Name | USP10 | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_101889/hsa_circ_0040705 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr16:84792321-84801964:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000103194.11 | ||||
| Gene Name | USP10 | Detection pipeline | N/A | ||||
| Sample Type | Systemic Lupus Erythematosus | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | ACAAGATACGCACAGTCCAGGAT | ||||||||
| Reverse Primer | TGTAGCACCAGTTCCCTTTATTGA | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |