Aliases hsa_circ_0041103 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr16:89962397-89967202:+
CircRNA type . Gene ID ENSG00000141002.14
Gene Name TCF25 Detection pipeline .
Sample Type Nhek; K562; Huvec; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra; Mcf7
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_19216 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr16:89962397-89967202
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver_T14;Liver_N13;Liver_T13;Temporal;Thyroid;H9;HepG2;BJ;HUVEC;Liver_N7;NHEK;Liver_N14;Liver_N11;AG04450;Liver;GM12878;PA1;SH-SY5Y_D0_exp1;Diencephalon;Cortex;Parietal;Occipital;H1;K562;Cerebellum;HeLa_S3;A549;Liver_T12;Hs68;Liver_N19;Liver_N17
Method for Estimation Ribo-;RNaseR;poly(A)-
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases hsa_circRNA_101922 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr16:89962397-89967202:+
CircRNA type exonic Gene ID ENSG00000141002.14
Gene Name TCF25 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases circTCF25/hsa_circ_0041103 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr16:89962397-89967202:+
CircRNA type N/A Gene ID ENSG00000141002.14
Gene Name TCF25 Detection pipeline N/A
Sample Type Bladder cancer
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer GATACAGCAGGCGCTCACCAT
Reverse Primer TCGGGTCTGCGGTAATCCA
Pubmed 27484176
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size