Aliases hsa_circ_0005603 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr17:11958205-12016677:+
CircRNA type . Gene ID ENSG00000154957.13
Gene Name ZNF18 Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; Nhek; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_19260 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr17:11958205-12016677
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver_N15;Liver_T7;Liver_N13;Liver_N12;Liver_N10;Liver_T8;Diencephalon;Liver_T12;H9;GM12878;Liver_T3;A549;Liver_T11;NHEK;Liver_N14;H1;HeLa_S3;Occipital;Lung;Thyroid;Parietal;PA1;Liver_N6;Liver_N3;Cerebellum;Liver_N11;Forebrain;BJ;Liver_T10;Temporal;Liver;SH-SY5Y_D4_exp2;Stomach;Heart;AG04450;Liver_T14;Liver_N8;Liver_T13;Cortex;Liver_T6;Liver_N7;SH-SY5Y_D2_exp1;SH-SY5Y_D4_exp1;Hs68;Liver_N22;Liver_N20;Liver_N18;Liver_N19;Liver_T18;Liver_T17;Liver_N21;Liver_N17;Liver_T22;Liver_T21
Method for Estimation Ribo-;RNaseR;poly(A)-
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases hsa_circRNA_101983 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr17:11958205-12016677:+
CircRNA type exonic Gene ID ENSG00000154957.13
Gene Name ZNF18 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circ_0005603 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr17:11958205-12016677:+
CircRNA type N/A Gene ID ENSG00000154957.13
Gene Name ZNF18 Detection pipeline N/A
Sample Type Gliomas
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer ATCAGTGGACAGCTTGTGGA
Reverse Primer TCCTGATGACTCAATGCTGTG
Pubmed 28236760
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size