| Aliases | hsa_circ_0041150 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:131558-177370:- | ||||
| CircRNA type | . | Gene ID | ENSG00000268320.3 | ||||
| Gene Name | SCGB1C2 | Detection pipeline | . | ||||
| Sample Type | Hepg2; A549 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_19290 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:131558-177370 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Liver_T14;Liver_T3;A549;Liver_N7;Lung;Cortex;Liver_N12;Thyroid;Liver_T12;Cerebellum;Liver_N3;Liver_N15;Liver_N11;Liver_N10;Liver_N8;Liver_T7;Liver_N14;Liver_N13;Liver_T8;Liver_N6;Liver_T15;Liver;Hs68;Liver_N17;Liver_N19;Liver_N21;Liver_T18;Liver_N18;Liver_T19;Liver_T22;Liver_N22 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_101924 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:131558-177370:- | ||||
| CircRNA type | exonic | Gene ID | ENSG00000268320.3 | ||||
| Gene Name | SCGB1C2 | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0041150 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:131558-177370:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000268320.3 | ||||
| Gene Name | SCGB1C2 | Detection pipeline | N/A | ||||
| Sample Type | Pancreatic Ductal Adenocarcinoma | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GGAAGAAAGTCTGCACCAAATG | ||||||||
| Reverse Primer | TTGGGGCAAACCCACTGAT | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |