Aliases hsa_circ_0004018 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr17:1703150-1704318:-
CircRNA type . Gene ID ENSG00000185561.9
Gene Name TLCD2 Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; Nhek; K562; Huvec; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra; Mcf7
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_19449 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr17:1703150-1704318
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type SH-SY5Y_D0_exp2;H1;Diencephalon;PA1;Liver;Liver_T11;SH-SY5Y_D2_exp1;Parietal;HeLa_S3;AG04450;Liver_N11;Cortex;NHEK;A549;Liver_N12;K562;Occipital;Liver_N15;HUVEC;Liver_N14;Liver_N7;Liver_T7;BJ;GM12878;Hs68;Liver_N18;Liver_T20;Liver_T18;Liver_N20;Liver_N17;Liver_T17;Liver_N22;Liver_N19
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases circ_007765 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr17:1703150-1704318:-
CircRNA type n/a Gene ID ENSG00000185561.9
Gene Name TLCD2 Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25624062
Aliases hsa_circRNA_101940 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr17:1703150-1704318:-
CircRNA type exonic Gene ID ENSG00000185561.9
Gene Name TLCD2 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circ_0004018 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr17:1703150-1704318:-
CircRNA type N/A Gene ID ENSG00000185561.9
Gene Name TLCD2 Detection pipeline N/A
Sample Type Liver cell carcinoma
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer TCAACCTTTTGCCCCACACT
Reverse Primer AAGACACGTCTGTGTGTTGT
Pubmed 28938566
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size