Aliases hsa_circ_0000745 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr17:20107645-20109225:+
CircRNA type . Gene ID ENSG00000128487.16
Gene Name SPECC1 Detection pipeline .
Sample Type HEK293; Nhek; K562; Huvec; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra; Mcf7
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_19689 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr17:20107645-20109225
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type PA1;Liver_T6;Liver_T3;GM12878;SH-SY5Y_D0_exp2;Liver_T15;Liver_T7;SH-SY5Y_D8_exp2;SH-SY5Y_D4_exp1;SH-SY5Y_D4_exp2;Stomach;HeLa_S3;Lung;H9;Liver_T14;Diencephalon;K562;SH-SY5Y_D0_exp1;BJ;Liver_N6;Liver_N15;Parietal;Liver_N11;Thyroid;HepG2;Liver;SK_N_SH;Cortex;Liver_N14;Occipital;Liver_T11;Liver_N8;HUVEC;Liver_N10;A549;AG04450;SH-SY5Y_D2_exp1;Temporal;Liver_T10;Liver_N3;Forebrain;Liver_T12;Liver_N7;Cerebellum;Liver_T13;Kidney;H1;Liver_N12;Liver_N13;NHEK;Liver_T8;Hs68;Liver_T21;Liver_N18;Liver_T19;Liver_T17;Liver_N22;Liver_T22;Liver_T18;Liver_N19;Liver_N17;Liver_N20;Liver_N21
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases circ_008716 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr17:20107645-20109225:+
CircRNA type n/a Gene ID ENSG00000128487.16
Gene Name SPECC1 Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25624062
Aliases chr17:20107645-20109225 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr17:20107645-20109225:n/a
CircRNA type n/a Gene ID ENSG00000263494.1;ENSG00000128487.12
Gene Name AC004702.2;SPECC1 Detection pipeline UROBORUS
Sample Type gliomas
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 26873924
Aliases hsa_circRNA_101996 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr17:20107645-20109225:+
CircRNA type exonic Gene ID ENSG00000128487.16
Gene Name SPECC1 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circ_0000745 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr17:20107645-20109225:+
CircRNA type N/A Gene ID ENSG00000128487.16
Gene Name SPECC1 Detection pipeline N/A
Sample Type Gastric cancer
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer GTTGAAAGTAGCCCGAGCAG
Reverse Primer ACGTGGCACAGACCTCTCTC
Pubmed 28974900
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size