| Aliases | hsa_circ_0003586 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:29550461-29554624:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000160551.11 | ||||
| Gene Name | TAOK1 | Detection pipeline | . | ||||
| Sample Type | Hs68_RNase; Hs68_control; K562; H1hesc; Gm12878; Ag04450 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_20078 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:29550461-29554624 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | H9;Stomach;Liver_N13;Temporal;PA1;Parietal;Liver_T11;Liver_N6;Liver_T13;Lung;Cortex;SH-SY5Y_D4_exp1;Liver_N12;K562;Liver;AG04450;Liver_N3;Liver_T6;SH-SY5Y_D2_exp1;Liver_N15;Liver_N7;SH-SY5Y_D0_exp1;Liver_N14;Liver_T12;Liver_T10;Forebrain;Liver_N11;Diencephalon;H1;Thyroid;Heart;Occipital;Cerebellum;Hs68;Liver_T22;Liver_T19;Liver_N21;Liver_N20;Liver_N17;Liver_T17;Liver_N19;Liver_N22 | ||||||||
| Method for Estimation | RNaseR;Ribo-;poly(A)- | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0003586 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:29550461-29554624:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000160551.11 | ||||
| Gene Name | TAOK1 | Detection pipeline | N/A | ||||
| Sample Type | Gliomas | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CCTTAACTATCCAAAAGCCAAA | ||||||||
| Reverse Primer | TCAATATTTCCCGCAACCAC | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |