Aliases hsa_circ_0005397 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr17:30500849-30503232:+
CircRNA type . Gene ID ENSG00000126858.12
Gene Name RHOT1 Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; Nhek; K562; Huvec; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_20144 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr17:30500849-30503232
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type K562;Liver_N14;Occipital;Cerebellum;HeLa_S3;Liver_T12;Parietal;Liver_T13;Liver;H1;A549;Liver_N8;GM12878;Liver_N12;Liver_N10;Liver_T3;Temporal;NHEK;Diencephalon;SH-SY5Y_D0_exp1;Stomach;Liver_N13;Lung;SH-SY5Y_D0_exp2;Liver_N15;Liver_N6;BJ;AG04450;Heart;Forebrain;Liver_N7;H9;Thyroid;PA1;Liver_T8;Cortex;Hs68;Liver_T20;Liver_N21;Liver_N20;Liver_T21;Liver_T18;Liver_T17;Liver_N19;Liver_N18;Liver_N22;Liver_T19;Liver_T22;Liver_N17
Method for Estimation poly(A)-;Ribo-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases hsa_circRNA_102034 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr17:30500849-30503232:+
CircRNA type exonic Gene ID ENSG00000126858.12
Gene Name RHOT1 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circ_0005397 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr17:30500849-30503232:+
CircRNA type N/A Gene ID ENSG00000126858.12
Gene Name RHOT1 Detection pipeline N/A
Sample Type Pancreatic Ductal Adenocarcinoma
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer GTCATCTGTATAGTGTATGCCGTTA
Reverse Primer CAGCTGGAATGGTGATTTCTT
Pubmed 27997903
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size