| Aliases | hsa_circ_0043138 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:34147027-34149837:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000108684.14 | ||||
| Gene Name | ASIC2 | Detection pipeline | . | ||||
| Sample Type | Nhek; K562; Hepg2; Helas3; Gm12878; A549 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_20262 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:34147027-34149837 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | A549;Liver_N13;Liver_N15;Cortex;Cerebellum;Liver_N8;Stomach;GM12878;Lung;K562;Liver_N12;Occipital;Forebrain;Temporal;Liver_N11;HeLa_S3;PA1;HepG2;Liver;Liver_N10;Liver_T7;Liver_T11;NHEK;Hs68;Liver_N17;Liver_T19;Liver_T17;Liver_N18;Liver_N19;Liver_N21;Liver_T21 | ||||||||
| Method for Estimation | poly(A)-;Ribo-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_006016 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:34147027-34149837:+ | ||||
| CircRNA type | n/a | Gene ID | ENSG00000108684.14 | ||||
| Gene Name | ASIC2 | Detection pipeline | Find_circ | ||||
| Sample Type | colorectal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_102039 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:34147027-34149837:+ | ||||
| CircRNA type | exonic | Gene ID | ENSG00000108684.14 | ||||
| Gene Name | ASIC2 | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_102039/hsa_circ_0043138 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:34147027-34149837:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000108684.14 | ||||
| Gene Name | ASIC2 | Detection pipeline | N/A | ||||
| Sample Type | Infantile Hemangioma (IH) | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CTACAGCCACCACACACAAGT | ||||||||
| Reverse Primer | GTCCATAAGAGGAATCAGTCGT | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |