Aliases HSA_CIRCpedia_78516 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr17:38065210-38066177
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver_N15;Liver_T12;Liver_T8;Liver_N7;Liver_N10;Liver_N13;Liver_T3;Forebrain;Liver_N14;Temporal;Cortex;Liver_N11;Diencephalon;Cerebellum;Parietal;Liver_N8;Liver_N12;Stomach;Liver_T7;Occipital;Liver_N6;Liver_T14;Liver_N3;Liver;Hs68;Liver_N18;Liver_N17;Liver_T17;Liver_N22;Liver_N20;Liver_N21;Liver_T20;Liver_N19
Method for Estimation Ribo-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases GSDMB ecircRNA/hsa_circ_0106803 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr17:38065210-38066177:-
CircRNA type N/A Gene ID ENSG00000278299.5
Gene Name TBC1D3C Detection pipeline N/A
Sample Type Multiple sclerosis
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer GGGGATTCTCACAACTTCCA
Reverse Primer CTCCTTGTTGGGGAAGACAA
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size