| Aliases | hsa_circ_0043497 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:38209550-38209888:- | ||||
| CircRNA type | . | Gene ID | ENSG00000008838.13 | ||||
| Gene Name | MED24 | Detection pipeline | . | ||||
| Sample Type | K562; Helas3; Gm12878; Ag04450; Sknshra | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_20556 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:38209550-38209888 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | K562;Liver_N15;PA1;AG04450;Cerebellum;Liver_N10;HeLa_S3;Diencephalon;A549;Liver_T8;Occipital;GM12878;Parietal;Liver_T14;H1;Stomach;SH-SY5Y_D0_exp1;Liver;Temporal;BJ;Cortex;H9;Hs68;Liver_N19;Liver_N20;Liver_N22 | ||||||||
| Method for Estimation | poly(A)-;Ribo-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_102065 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:38209550-38209888:- | ||||
| CircRNA type | exonic | Gene ID | ENSG00000008838.13 | ||||
| Gene Name | MED24 | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0043497 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:38209550-38209888:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000008838.13 | ||||
| Gene Name | MED24 | Detection pipeline | N/A | ||||
| Sample Type | Tuberculosis | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | TCAACCTGGCAGATGCGTTA | ||||||||
| Reverse Primer | TTTCACTCTGAGCAGGTGGC | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |