| Aliases | chr17:59853761|59861785 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:59853761-59861785:n/a | ||||
| CircRNA type | n/a | Gene ID | ENSG00000136492.4 | ||||
| Gene Name | BRIP1 | Detection pipeline | n/a | ||||
| Sample Type | Breast cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_21804 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:59853761-59861785 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | HUVEC;SH-SY5Y_D2_exp1;PA1;Liver_T12;Liver_T14;K562;Liver_T7;SH-SY5Y_D8_exp2;SH-SY5Y_D4_exp2;Liver_T3;A549;AG04450;Hs68 | ||||||||
| Method for Estimation | poly(A)-;Ribo-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circBRIP | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:59853761-59861785:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000108423.14 | ||||
| Gene Name | TUBD1 | Detection pipeline | N/A | ||||
| Sample Type | breast cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | TCTTATTCTAGTGGATGATCGCTTT | ||||||||
| Reverse Primer | GAAGGTGGTGTGCTTGGATAGTT | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |