| Aliases | chr17:60061531|60062451 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:60061531-60062451:n/a | ||||
| CircRNA type | n/a | Gene ID | ENSG00000108510.5 | ||||
| Gene Name | MED13 | Detection pipeline | n/a | ||||
| Sample Type | Breast cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0002220 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:60061531-60062451:- | ||||
| CircRNA type | . | Gene ID | ENSG00000108510.5 | ||||
| Gene Name | MED13 | Detection pipeline | . | ||||
| Sample Type | Hs68_RNase; Hs68_control | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_21867 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:60061531-60062451 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Forebrain;Liver_T7;Occipital;SH-SY5Y_D4_exp1;Liver_N15;Liver_T14;Liver_T10;Liver_T15;Liver_N13;K562;Liver_T13;Parietal;Liver_T8;Liver_T6;GM12878;PA1;Liver_N11;Liver;SH-SY5Y_D0_exp1;Cerebellum;Liver_N14;Lung;Liver_N8;Liver_N7;Temporal;SH-SY5Y_D4_exp2;SH-SY5Y_D2_exp1;Heart;Liver_N6;Liver_N10;SH-SY5Y_D8_exp2;Stomach;SH-SY5Y_D0_exp2;Cortex;Diencephalon;H1;A549;H9;Liver_T12;Liver_N12;NHEK;Liver_T3;Liver_N3;Hs68;Liver_T18;Liver_N21;Liver_N22;Liver_N18;Liver_T21;Liver_T20;Liver_N20;Liver_N19;Liver_T22;Liver_T17;Liver_T19;Liver_N17 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_005140 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:60061531-60062451:- | ||||
| CircRNA type | n/a | Gene ID | ENSG00000108510.5 | ||||
| Gene Name | MED13 | Detection pipeline | Find_circ | ||||
| Sample Type | colorectal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circMED13 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:60061531-60062451:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000108510.5 | ||||
| Gene Name | MED13 | Detection pipeline | N/A | ||||
| Sample Type | breast cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | ATCGGCTACTATCAACAGAACCTC | ||||||||
| Reverse Primer | GAGTAGGAATGTCTGACTGAGGGA | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |