| Aliases | hsa_circ_0007534 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:61869771-61877977:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000202361.1 | ||||
| Gene Name | RF00019 | Detection pipeline | . | ||||
| Sample Type | Hs68_RNase; Hs68_control | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_21978 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:61869771-61877977 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Liver_T6;Liver_N12;Cortex;Occipital;Diencephalon;Lung;Temporal;Liver_N3;Parietal;Thyroid;Cerebellum;Liver_N8;Liver_T3;Liver_N15;Hs68;Liver_N19;Liver_T18;Liver_N20;Liver_N17 | ||||||||
| Method for Estimation | Ribo-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0007534 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:61869771-61877977:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000202361.1 | ||||
| Gene Name | RF00019 | Detection pipeline | N/A | ||||
| Sample Type | breast cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GTGACGGAAATCCAATTGCACC | ||||||||
| Reverse Primer | ATGGAATTGCTGGCGAGTTG | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |