| Aliases | hsa_circ_0046366 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:80048757-80048945:- | ||||
| CircRNA type | . | Gene ID | ENSG00000169710.6 | ||||
| Gene Name | FASN | Detection pipeline | . | ||||
| Sample Type | Hepg2 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circRNA_0046366 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:80048757-80048945:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000169710.6 | ||||
| Gene Name | FASN | Detection pipeline | N/A | ||||
| Sample Type | Hepatic steatosis | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CGTCCATTCGTTTGTGAGCC | ||||||||
| Reverse Primer | CTTCACAGCCTCATCGGAGC | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |