| Aliases | hsa_circ_0046599 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:80962990-80972395:- | ||||
| CircRNA type | . | Gene ID | ENSG00000141564.14 | ||||
| Gene Name | RPTOR | Detection pipeline | . | ||||
| Sample Type | Hepg2; Helas3 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_22981 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:80962990-80972395 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | K562;BJ;HeLa_S3;Hs68 | ||||||||
| Method for Estimation | poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_100226/hsa_circ_0046599 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:80962990-80972395:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000141564.14 | ||||
| Gene Name | RPTOR | Detection pipeline | N/A | ||||
| Sample Type | Systemic Lupus Erythematosus | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | TCGCTGACAGGTCCAGTTGC | ||||||||
| Reverse Primer | CTGTTTCTTGCTGTAGACGGCTC | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |