Aliases circRNA3706 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr18:23909153-23939386:+
CircRNA type circRNA Gene ID ENSG00000264911.1;ENSG00000141384.7
Gene Name RP11-107K17.2;TAF4B Detection pipeline find_circ
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 29218114
Aliases circRNA3706 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr18:23909153-23939386:+
CircRNA type N/A Gene ID ENSG00000264911.1;ENSG00000141384.7
Gene Name RP11-107K17.2;TAF4B Detection pipeline N/A
Sample Type Esophageal cancer
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer ACATTCCCACCAGCCA
Reverse Primer CGCCAAAGATCAGGTAGT
Pubmed 29218114
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size
171 AGGAAAACTCTATGGGtggga tgtctcatgcctgtaatccca 47.619 47.619 58.071 58.804 184 354 21 21
181 tggacatttaggttgtttccagg tagtggtgtgtgcgtgtagt 43.478 50 58.851 58.966 43 223 23 20
175 AACTCTATGGGtgggactaca tgggcacagtgtctcatgc 47.619 57.895 57.515 60.303 189 363 21 19
211 tgcctttattgcctcagataaca agcttgaacactgtagggaga 39.13 47.619 58.146 58.39 70 280 23 21
179 caaccctccaatggacatttag gtgtagtcccaCCCATAGAGT 45.455 52.381 57.011 58.252 32 210 22 21
128 gcacttatattgttgtgtgcttg cgtagtggtgtgtgcgtg 39.13 61.111 57.002 58.769 98 225 23 18
181 ctccaatggacatttaggttgtt tgtgtgcgtgtagtcccaC 39.13 57.895 57.017 59.932 37 217 23 19
171 AGGAAAACTCTATGGGtggga tgtctcatgcctgtaatccca 47.619 47.619 58.071 58.804 184 354 21 21
181 tggacatttaggttgtttccagg tagtggtgtgtgcgtgtagt 43.478 50 58.851 58.966 43 223 23 20
175 AACTCTATGGGtgggactaca tgggcacagtgtctcatgc 47.619 57.895 57.515 60.303 189 363 21 19
211 tgcctttattgcctcagataaca agcttgaacactgtagggaga 39.13 47.619 58.146 58.39 70 280 23 21
179 caaccctccaatggacatttag gtgtagtcccaCCCATAGAGT 45.455 52.381 57.011 58.252 32 210 22 21
128 gcacttatattgttgtgtgcttg cgtagtggtgtgtgcgtg 39.13 61.111 57.002 58.769 98 225 23 18
181 ctccaatggacatttaggttgtt tgtgtgcgtgtagtcccaC 39.13 57.895 57.017 59.932 37 217 23 19
171 AGGAAAACTCTATGGGtggga tgtctcatgcctgtaatccca 47.619 47.619 58.071 58.804 184 354 21 21
181 tggacatttaggttgtttccagg tagtggtgtgtgcgtgtagt 43.478 50 58.851 58.966 43 223 23 20
175 AACTCTATGGGtgggactaca tgggcacagtgtctcatgc 47.619 57.895 57.515 60.303 189 363 21 19
211 tgcctttattgcctcagataaca agcttgaacactgtagggaga 39.13 47.619 58.146 58.39 70 280 23 21
179 caaccctccaatggacatttag gtgtagtcccaCCCATAGAGT 45.455 52.381 57.011 58.252 32 210 22 21
181 ctccaatggacatttaggttgtt tgtgtgcgtgtagtcccaC 39.13 57.895 57.017 59.932 37 217 23 19
128 gcacttatattgttgtgtgcttg cgtagtggtgtgtgcgtg 39.13 61.111 57.002 58.769 98 225 23 18