| Aliases | hsa_circ_0108308 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr18:32335939-32374214:n/a | ||||
| CircRNA type | n/a | Gene ID | ENSG00000134769.17;ENSG00000268873.1 | ||||
| Gene Name | DTNA;RP11-138H11.1 | Detection pipeline | n/a | ||||
| Sample Type | multiple system atrophy | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_88345 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr18:32335939-32374214 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Temporal;H1;Occipital;Cortex;Liver;Cerebellum;Liver_N11;Parietal;Liver_T7;Diencephalon;Liver_T12;Thyroid;Hs68;Liver_N17;Liver_T17 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | DTNA/hsa_circ_0108308 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr18:32335939-32374214:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000141441.15 | ||||
| Gene Name | GAREM1 | Detection pipeline | N/A | ||||
| Sample Type | Multiple system atrophy (MSA) | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | ACTGAACTCAACGTGTCCCG | ||||||||
| Reverse Primer | TTCAATCATTGGATCAAACG | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |