| Aliases | hsa_circ_0007006 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr18:46783379-46808545:- | ||||
| CircRNA type | . | Gene ID | ENSG00000078043.15 | ||||
| Gene Name | PIAS2 | Detection pipeline | . | ||||
| Sample Type | Hs68_RNase; Hs68_control; K562; Hepg2; Helas3; Ag04450; A549; Sknshra | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_23919 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr18:46783379-46808545 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Parietal;Liver_N14;PA1;H9;Liver_T12;AG04450;K562;HepG2;Liver_N12;Liver_N13;Kidney;HeLa_S3;Forebrain;Liver_T14;A549;Cortex;Diencephalon;Liver;Hs68;Liver_N22;Liver_N21;Liver_T17 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_102364 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr18:46783379-46808545:- | ||||
| CircRNA type | exonic | Gene ID | ENSG00000078043.15 | ||||
| Gene Name | PIAS2 | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0007006 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr18:46783379-46808545:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000078043.15 | ||||
| Gene Name | PIAS2 | Detection pipeline | N/A | ||||
| Sample Type | Colorectal cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | TGTCGGCACAGTTTCGTTCTC | ||||||||
| Reverse Primer | TTGATCTGGAAGGCATGTGGA | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |