| Aliases | hsa_circ_0000096 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:100515464-100535241:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000156875.9;ENSG00000241073.1 | ||||
| Gene Name | HIAT1;RP4-714D9.2 | Detection pipeline | . | ||||
| Sample Type | cd_19; Hs68_RNase; Hs68_control | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_26981 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:100515464-100535241 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Liver_T10;NHEK;Lung;Diencephalon;HeLa_S3;BJ;Parietal;H9;PA1;K562;Liver;AG04450;Heart;Occipital;SH-SY5Y_D0_exp2;GM12878;Liver_N10;H1;HepG2;HUVEC;Liver_N14;Temporal;Cerebellum;Liver_N12;Cortex;Hs68;Liver_T19;Liver_N18;Liver_T17;Liver_N20;Liver_N17 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0000096 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:100515464-100535241:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000156875.9;ENSG00000241073.1 | ||||
| Gene Name | HIAT1;RP4-714D9.2 | Detection pipeline | N/A | ||||
| Sample Type | Gastric cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CAGTCCTTGGCATTCTTTCC | ||||||||
| Reverse Primer | GTGGGTGCTGTCAATAGTCC | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |