| Aliases | hsa_circ_0046701 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr18:745707-751804:- | ||||
| CircRNA type | . | Gene ID | ENSG00000176105.9;ENST00000577961.5 | ||||
| Gene Name | YES1;YES1 | Detection pipeline | . | ||||
| Sample Type | K562 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_131960 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr18:745707-751804 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | PA1;Liver_T8;Liver_N8 | ||||||||
| Method for Estimation | Ribo- | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_131960 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr18:745707-751804 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | K562 | ||||||||
| Method for Estimation | poly(A)- | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0046701 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr18:745707-751804:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000176105.9;ENST00000577961.5 | ||||
| Gene Name | YES1;YES1 | Detection pipeline | N/A | ||||
| Sample Type | Gliomas | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CACAACCAGAGCACAATTTGA | ||||||||
| Reverse Primer | TGGATCATCAACCAGCTCAG | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |