Aliases HSA_CIRCpedia_27144 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr1:107324281-107324922
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Cortex;Occipital;Temporal;Cerebellum;Diencephalon;Hs68;Forebrain;Liver_T15;Liver_T8;Liver_T13;Liver_T21
Method for Estimation RNaseR;Ribo-;poly(A)-
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases chr1|107324281-107324922 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr1:107324281-107324922:n/a
CircRNA type circRNA Gene ID NA
Gene Name NA Detection pipeline CIRCexplorer2
Sample Type PDLSC osteogenis
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 29197342
Aliases circ_007858 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr1:107324281-107324922:+
CircRNA type . Gene ID ENSG00000162631.18;NM_001312688
Gene Name NTNG1;NTNG1 Detection pipeline .
Sample Type SRR1363096
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed .
Aliases circ_007120 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr1:107324281-107324922:+
CircRNA type . Gene ID ENSG00000162631.18;NM_001312688
Gene Name NTNG1;NTNG1 Detection pipeline .
Sample Type SRR1363098
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed .
Aliases circ_008258 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr1:107324281-107324922:+
CircRNA type . Gene ID ENSG00000162631.18;NM_001312688
Gene Name NTNG1;NTNG1 Detection pipeline .
Sample Type SRR1363099
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed .
Aliases circ_007403 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr1:107324281-107324922:+
CircRNA type . Gene ID ENSG00000162631.18;NM_001312688
Gene Name NTNG1;NTNG1 Detection pipeline .
Sample Type SRR1363100
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed .
Aliases circ_007003 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr1:107324281-107324922:+
CircRNA type . Gene ID ENSG00000162631.18;NM_001312688
Gene Name NTNG1;NTNG1 Detection pipeline .
Sample Type SRR2131537
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed .
Aliases circ_006435 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr1:107324281-107324922:+
CircRNA type . Gene ID ENSG00000162631.18;NM_001312688
Gene Name NTNG1;NTNG1 Detection pipeline .
Sample Type SRR2131540
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed .
Aliases circ_006710 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr1:107324281-107324922:+
CircRNA type . Gene ID ENSG00000162631.18;NM_001312688
Gene Name NTNG1;NTNG1 Detection pipeline .
Sample Type SRR2131542
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed .
Aliases circ_005277 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr1:107324281-107324922:+
CircRNA type . Gene ID ENSG00000162631.18;NM_001312688
Gene Name NTNG1;NTNG1 Detection pipeline .
Sample Type SRR2131545
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed .
Aliases circ_003915 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr1:107324281-107324922:+
CircRNA type . Gene ID ENSG00000162631.18;NM_001312688
Gene Name NTNG1;NTNG1 Detection pipeline .
Sample Type SRR3084937
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed .
Aliases circRNA NTNG1 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr1:107324281-107324922:+
CircRNA type N/A Gene ID ENSG00000162631.18;NM_001312688
Gene Name NTNG1;NTNG1 Detection pipeline N/A
Sample Type PDLSC osteogenis
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer AGACATAAAGGTGCGAGGAAGG
Reverse Primer TTGCACATGTAGGGATTGCC
Pubmed 29197342
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size