| Aliases | hsa_circ_0006054 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr19:34818325-34821252:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000267767.2 | ||||
| Gene Name | LINC01801 | Detection pipeline | . | ||||
| Sample Type | Hs68_RNase; Hs68_control | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_25549 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr19:34818325-34821252 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Liver_T12;Thyroid;Liver_T14;Cortex;Heart;Occipital;Cerebellum;BJ;A549;Liver_N12;Liver_N8;Liver;Temporal;Liver_T7;H1;Liver_T6;Diencephalon;Liver_N15;Parietal;Liver_N11;AG04450;Liver_T11;PA1;Stomach;Hs68;Liver_N21;Liver_T17;Liver_N19;Liver_N17;Liver_T22;Liver_N22;Liver_N18;Liver_T19;Liver_T21 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_006054/hsa_circ_0006054 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr19:34818325-34821252:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000267767.2 | ||||
| Gene Name | LINC01801 | Detection pipeline | N/A | ||||
| Sample Type | breast cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | TCCTGTGACTGAAGTGCTGA | ||||||||
| Reverse Primer | GTCTAGATGTCGCCAGTCCA | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |