Aliases hsa_circ_0006427 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr1:94032835-94033408:-
CircRNA type . Gene ID ENSG00000137936.12
Gene Name BCAR3 Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; Nhek; K562; Huvec; Hepg2; H1hesc; Gm12878; Bj; Ag04450; A549
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_33225 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr1:94032835-94033408
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver_T12;H9;Liver_T6;GM12878;A549;Liver_N14;Liver_T11;HUVEC;Occipital;Liver_T13;Liver_T14;HeLa_S3;Kidney;Liver_N15;Temporal;HepG2;Liver;Liver_N3;AG04450;H1;Thyroid;NHEK;BJ;Liver_N6;Liver_N12;Diencephalon;Liver_N7;Cortex;Liver_T7;PA1;Liver_N10;Liver_T8;Liver_N11;Liver_T15;K562;Liver_N8;Cerebellum;Parietal;Liver_N13;Hs68;Liver_T20;Liver_T18;Liver_N21;Liver_N19;Liver_N18;Liver_N17;Liver_T17;Liver_T21;Liver_N20;Liver_N22
Method for Estimation Ribo-;RNaseR;poly(A)-
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases hsa_circRNA_100281 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr1:94032835-94033408:-
CircRNA type exonic Gene ID ENSG00000137936.12
Gene Name BCAR3 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circ_0006427 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr1:94032835-94033408:-
CircRNA type N/A Gene ID ENSG00000137936.12
Gene Name BCAR3 Detection pipeline N/A
Sample Type Primary Great Saphenous Vein Varicosities
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer ACCCCCGAGAAACTGAAGAAG
Reverse Primer TTGAAGTGCTGAGCGAGGTT
Pubmed 29577902
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size