Aliases hsa_circ_0008615 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr19:45901262-45901597:-
CircRNA type . Gene ID ENSG00000104881.10
Gene Name PPP1R13L Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; Hepg2; Helas3; H1hesc; Bj; Ag04450; Nhek; Sknshra
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases HSA_CIRCpedia_26169 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr19:45901262-45901597
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Diencephalon;Liver_N12;Liver_T8;H1;PA1;AG04450;Thyroid;BJ;Liver_N11;SH-SY5Y_D0_exp1;Cortex;HeLa_S3;Parietal;NHEK;Liver_T14;HepG2;Liver_N3;Liver_N13;Hs68;Liver_T17;Liver_N19;Liver_T19;Liver_T21;Liver_N18
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circ_102571/hsa_circ_0008615 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr19:45901262-45901597:-
CircRNA type N/A Gene ID ENSG00000104881.10
Gene Name PPP1R13L Detection pipeline N/A
Sample Type Systemic Lupus Erythematosus
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer GTGGATGAACTGACCAAGCAGC
Reverse Primer TGGAAGTTCATGTCCAGAAAGTCC
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size