Aliases hsa_circ_0003146 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr19:48229068-48229481:+
CircRNA type . Gene ID ENSG00000268746.1;ENSG00000024422.7
Gene Name CTD-2571L23.8;EHD2 Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; Nhek; Hsmm; Hepg2; Helas3; Bj
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_26310 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr19:48229068-48229481
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver_T14;Stomach;Liver_N3;Thyroid;Liver_N13;Lung;HepG2;PA1;Liver_N7;HUVEC;BJ;HeLa_S3;Cerebellum;NHEK;AG04450;Hs68;Liver_T21;Liver_T19
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases hsa_circRNA_102584 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr19:48229068-48229481:+
CircRNA type exonic Gene ID ENSG00000268746.1;ENSG00000024422.7
Gene Name CTD-2571L23.8;EHD2 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circ_102584/hsa_circ_0003146 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr19:48229068-48229481:+
CircRNA type N/A Gene ID ENSG00000268746.1;ENSG00000024422.7
Gene Name CTD-2571L23.8;EHD2 Detection pipeline N/A
Sample Type Systemic Lupus Erythematosus
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer GACCTCTTCCGCGACATCCA
Reverse Primer CACCACGCGGATCTTGTCCT
Pubmed 29360436
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size