Aliases hsa_circ_0052012 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr19:50902107-50902741:+
CircRNA type . Gene ID ENSG00000062822.8
Gene Name POLD1 Detection pipeline .
Sample Type Nhek; K562; Huvec; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra; Mcf7
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_26513 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr19:50902107-50902741
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Heart;Liver_N7;HUVEC;PA1;Temporal;BJ;H9;Liver_N11;K562;H1;HeLa_S3;Liver_T8;Liver_N6;Kidney;SH-SY5Y_D0_exp1;Lung;SH-SY5Y_D4_exp1;Liver_T10;Stomach;HepG2;Liver_N14;Liver_T6;Liver_T13;A549;GM12878;Liver_T12;AG04450;Liver_T11;Parietal;Liver_T14;Liver;NHEK;SK_N_SH;Liver_N3;Diencephalon;Occipital;Cerebellum;Liver_N15;Liver_N8;Thyroid;Liver_T3;Liver_N13;Cortex;Hs68;Liver_N22;Liver_N20;Liver_N18;Liver_T18;Liver_N17;Liver_T22;Liver_T19;Liver_N19;Liver_T20;Liver_T17;Liver_T21;Liver_N21
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases hsa_circRNA_102594 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr19:50902107-50902741:+
CircRNA type exonic Gene ID ENSG00000062822.8
Gene Name POLD1 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circRNA_102594/hsa_circ_0052012 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr19:50902107-50902741:+
CircRNA type N/A Gene ID ENSG00000062822.8
Gene Name POLD1 Detection pipeline N/A
Sample Type Rheumatoid Arthritis
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer CACCATCAGCCATAGATCCTC
Reverse Primer CTTGCCATCCATCCCACATA
Pubmed 28983619
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size