Aliases circRNA3594 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr19:58392976-58393487:+
CircRNA type circRNA Gene ID ENSG00000083845.8
Gene Name RPS5 Detection pipeline find_circ
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circRNA3594 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr19:58392976-58393487:+
CircRNA type N/A Gene ID ENSG00000083845.8
Gene Name RPS5 Detection pipeline N/A
Sample Type Esophageal cancer
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer GAGACGACAGGCTGTGGAT
Reverse Primer GGCAGGTACTTGGCATACTT
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size
302 tggatgacattgctggacct ccatcgcatactacctgggt 50 55 59.006 58.951 77 378 20 20
227 ccacaagctgactgaagagc tactacctgggtactgctgc 55 55 58.845 58.518 144 370 20 20
271 ctcgtggatgacattgctgg tcagggtccaagggttgttt 55 50 58.988 59.069 73 343 20 20
109 ccctgggtgagtcttgaaga caaccctgtcagactaccact 55 52.381 58.648 59.029 98 206 20 21
267 ggcaacattcaccacaagct gtctcagagtctcacccagt 50 55 59.324 58.082 133 399 20 20
190 agtggtagtctgacagggttg tcgcatactacctgggtactg 52.381 52.381 59.029 58.696 186 375 21 21
129 acattcaccacaagctgactg tgttttggtccagagtgtgtc 47.619 47.619 58.775 58.361 137 265 21 21
139 acaagctgactgaagagctct ccttcaaggcagcaggttct 47.619 55 59.03 60.251 146 284 21 20
209 tcaccacaagctgactgaag agttattcagggtccaagggt 50 47.619 57.755 58.356 141 349 20 21
245 ctgccctgggtgagtcttg ggtccaagggttgtttagtcag 63.158 50 60.003 58.853 95 339 19 22
273 ttggctcgtggatgacattg agggtccaagggttgtttagt 50 47.619 58.548 58.859 69 341 20 21
271 ctcgtggatgacattgctgg tcagggtccaagggttgttt 55 50 58.988 59.069 73 343 20 20
227 ccacaagctgactgaagagc tactacctgggtactgctgc 55 55 58.845 58.518 144 370 20 20
267 ggcaacattcaccacaagct gtctcagagtctcacccagt 50 55 59.324 58.082 133 399 20 20
302 tggatgacattgctggacct ccatcgcatactacctgggt 50 55 59.006 58.951 77 378 20 20
273 ttggctcgtggatgacattg agggtccaagggttgtttagt 50 47.619 58.548 58.859 69 341 20 21
129 acattcaccacaagctgactg tgttttggtccagagtgtgtc 47.619 47.619 58.775 58.361 137 265 21 21
139 acaagctgactgaagagctct ccttcaaggcagcaggttct 47.619 55 59.03 60.251 146 284 21 20
109 ccctgggtgagtcttgaaga caaccctgtcagactaccact 55 52.381 58.648 59.029 98 206 20 21
190 agtggtagtctgacagggttg tcgcatactacctgggtactg 52.381 52.381 59.029 58.696 186 375 21 21
245 ctgccctgggtgagtcttg ggtccaagggttgtttagtcag 63.158 50 60.003 58.853 95 339 19 22
209 tcaccacaagctgactgaag agttattcagggtccaagggt 50 47.619 57.755 58.356 141 349 20 21
302 tggatgacattgctggacct ccatcgcatactacctgggt 50 55 59.006 58.951 77 378 20 20
271 ctcgtggatgacattgctgg tcagggtccaagggttgttt 55 50 58.988 59.069 73 343 20 20
227 ccacaagctgactgaagagc tactacctgggtactgctgc 55 55 58.845 58.518 144 370 20 20
267 ggcaacattcaccacaagct gtctcagagtctcacccagt 50 55 59.324 58.082 133 399 20 20
139 acaagctgactgaagagctct ccttcaaggcagcaggttct 47.619 55 59.03 60.251 146 284 21 20
109 ccctgggtgagtcttgaaga caaccctgtcagactaccact 55 52.381 58.648 59.029 98 206 20 21
245 ctgccctgggtgagtcttg ggtccaagggttgtttagtcag 63.158 50 60.003 58.853 95 339 19 22
209 tcaccacaagctgactgaag agttattcagggtccaagggt 50 47.619 57.755 58.356 141 349 20 21
190 agtggtagtctgacagggttg tcgcatactacctgggtactg 52.381 52.381 59.029 58.696 186 375 21 21
273 ttggctcgtggatgacattg agggtccaagggttgtttagt 50 47.619 58.548 58.859 69 341 20 21
129 acattcaccacaagctgactg tgttttggtccagagtgtgtc 47.619 47.619 58.775 58.361 137 265 21 21